21A
Species: Homo sapiens
Position: chr8: 122692221-122692545
Known as:
Transcript: 21A
Sequence: Download
Description:
21A is one of a number of RNAP III-transcribed ncRNAs that have sequence complementarity to protein-coding genes, possibly acting as a natural trans-chromosomal antisense RNA. Aligned to the human genome, it shows several homology hits, among which the most highly significant were associated to multiple intronic regions of centromeric protein F gene (CENP-F). In vitro over-expression of 21A transcripts inhibits CENP-F protein accumulation and decreased levels of CENP-F mRNA, indicating that 21A regulates CENP-F expression in trans. 21A RNAs has a role in the control of the proliferation of human tumor cell lines, possibly via regulation of CENP-F expression. This effect was not observed in a mouse cell line.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TATTTCTTCCATCACCATAA | 122692662-122692681(-) | up stream | 20 | AGG | CRISPRko | High activity | HCT116 | 16.3-fold increase,paried with sgRNA2 | [1] |
| sgRNA2 | AAGTGTTTGAATTAGCAGGT | 122692175-122692194(+) | down stream | 20 | GGG | CRISPRko | High activity | HCT116 | 16.3-fold increase,paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Ho TT, Zhou N, Huang J, Koirala P, Xu M, et al. (2015). Targeting non-coding RNAs with the CRISPR/Cas9 system in human cell lines. Nucleic Acids Res 43(3): e17.
