AK023948
Species: Homo sapiens
Position: chr8: 133054958-133057767
Known as:
Transcript: AK023948
Sequence: Download
Description:
AK023948 (cDNA FLJ13886 fis, clone THYRO1001559) was cloned from thyroid gland and is 2,807b long. AK023948 is located in an intron of both the TG (sense orientation) and SLA (antisense) genes and significantly down-regulated in most papillary thyroid cancer (PTC), thus representing a candidate susceptibility gene for PTC. By using a CRISPR/Cas9-based synergistic activation mediator (SAM) system, AK023948 lncRNA was also demonstrated as a positive regulator for AKT, critical to AKT activity in response to various stimuli such as growth factors or acidosis. Mechanistically, AK023948 mediates AKT activation through interaction with DHX9 and p85. As a binding partner along with AK023948, DHX9 regulates the p85 stability. Both of AK023948 and DHX9 are upregulated in breast cancer; and associated with poor survival. Together, these results demonstrates two previously uncharacterized factors AK023948 and DHX9 as important players in the AKT pathway, and that their upregulation may contribute to breast tumour progression.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GAGTTTTAGTCACCTATCTA | 133055035-133055054(+) | gene body (near 5') | 20 | GGG | CRISPRko | High activity | MCF7 | paried with sgRNA2 | [1] [2] |
| sgRNA2 | GGTGATCCTTGTGCACGGCC | 133057907-133057926(+) | down stream | 20 | AGG | CRISPRko | High activity | MCF7 | paried with sgRNA1 | [1] [2] |
GBrowser
Links
Reference
1. Ho TT, Zhou N, Huang J, Koirala P, Xu M, et al. (2015). Targeting non-coding RNAs with the CRISPR/Cas9 system in human cell lines. Nucleic Acids Res 43(3): e17.
2. Koirala P, Huang J, Ho TT, Wu F, Ding X, et al. (2017). LncRNA AK023948 is a positive regulator of AKT. Nat Commun 8: 14422.