AK170409

Species: Mus musculus

Position: chrX: 19156980-19167232

Known as: ENSMUSG00000073274

Transcript: ENSMUST00000143129

Sequence: Download

Description:

lincRNA-AK170409 shows high induction with LPS and Pam3CSK4 in both primary macrophages and in our iBMDMs reporter cells, and possesses an inducible ChIP peak for transcription factor c-Jun, a component of the AP-1 transcription complex with roles in inflammation. It was localized strictly to the nucleus. Knocking out this lincRNA could be lethal to cells, whereas deletion of one allele of the AK70409 locus could resulted in 50% reduction in this lincRNA expression, as evaluated by qPCR. When lincRNA-AK170409 was knocked down, genes with known roles in the TLR-signaling pathway are altered, one of the most down-regulated genes was the aryl hydrocarbon receptor (Ahr) gene, which encodes a ligand-activated transcription factor known to regulate immune responses.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 GAAAAATTGGGTGTCTGGTT 19168204-19168223(-) up stream 20 TGG CRISPRko Experimental validated iBMDM NA [1]
sgRNA2 TTGACTTTAGATGTCGGTAA 19168158-19168177(-) up stream 20 AGG CRISPRko Experimental validated iBMDM NA [1]
sgRNA3 AGAGTATCTTCTCATAAGTA 19156453-19156472(+) down stream 20 AGG CRISPRko Experimental validated iBMDM NA [1]
sgRNA4 GCAGGAGTGATTGTATGAAG 19156387-19156406(-) down stream 20 TGG CRISPRko Experimental validated iBMDM NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Covarrubias S, Robinson EK, Shapleigh B, Vollmers A, Katzman S, et al. (2017). CRISPR/Cas-based screening of long non-coding RNAs (lncRNAs) in macrophages with an NF-κB reporter. J Biol Chem 292(51): 20911-20920.