ANRIL
Species: Homo sapiens
Position: chr9: 21994777-22121097
Known as: CDKN2B-AS1 , ENSG00000240498
Transcript: NR_003529 , NR_047532 , NR_047543 , NR_047535 , NR_047537 , NR_047534 , NR_047536 , NR_047538 , NR_120536 , NR_047539 , NR_047540 , NR_047541 , NR_047542 , NR_047533 , ENST00000428597 , ENST00000584351 , ENST00000580576 , ENST00000645313 , ENST00000644233 , ENST00000643286 , ENST00000585267 , ENST00000582072 , ENST00000580467 , ENST00000581051 , ENST00000577551 , ENST00000582301 , ENST00000584637 , ENST00000422420 , ENST00000583719 , ENST00000645223 , ENST00000584020 , ENST00000455933 , ENST00000421632 , ENST00000468603 , ENST00000584816
Sequence: Download
Description:
The lncRNA, ANRIL, is also involved in numerous diseases and has been demonstrated to promote DNA methylation, which may be a perinatal marker for subsequent adiposity. Overexpression of ANRIL has been reported to accelerate cell invasion and suppress apoptosis in osteosarcoma. ANRIL expression is upregulated in bladder cancer and promotes disease progression through the intrinsic pathway.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GGGGCGCGGCCTCGGCGGAT | 22008733-22008752(-) | gene body (near 5') | 20 | CGG | CRISPRi | Experimental validated | T24;5637 | NA | [1] |
| sgRNA2 | CCGCTCCTCGGCCAAGTCCA | 22006035-22006054(+) | gene body (near 5') | 20 | CGG | CRISPRi | Experimental validated | T24;5637 | NA | [1] |
| sgRNA3 | CGCCGCGGCGCGGGGACTAG | 22008875-22008894(-) | gene body (near 5') | 20 | TGG | CRISPRi | Experimental validated | T24;5637 | NA | [1] |
| sgRNA4 | GCAGCAGCAGCTCCGCCACG | 22006205-22006224(+) | gene body (near 5') | 20 | CGG | CRISPRi | Experimental validated | T24;5637 | NA | [1] |
| sgRNA5 | ACGGCCAACGGTGGATTATC | 22008983-22009002(-) | gene body (near 5') | 20 | CGG | CRISPRi | Experimental validated | T24;5637 | NA | [1] |
GBrowser
Links
Reference
1. Peng L, Pan P, Chen J, Yu X, Wu J, et al. (2018). A tetracycline-inducible CRISPR/Cas9 system, targeting two long non-coding RNAs, suppresses the malignant behavior of bladder cancer cells. Oncol Lett 16(4): 4309-4316.
