AP000254.8

Species: Homo sapiens

Position: chr21: 31666727-31667247

Known as:

Transcript: ENST00000609934

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 TTTTTCATTATTAGGCATGT 31667244-31667263(+) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 GTAACTGAGAGTTTACCCTT 31667029-31667048(+) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 CGTCTACACACTAATGCTCT 31667089-31667108(-) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 CCTGATTTCAGAAGTACCAA 31667048-31667067(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 TGCCAAAGGGGAACTAATAC 31666769-31666788(+) gene body (near 3') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 ATTTTTATATCAGAGGCCTT 31666962-31666981(+) gene body (near 3') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 TAGCTATGCCAGTAATTAAC 31666997-31667016(+) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 GAGTTATGCCTGTTAATTAC 31667008-31667027(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 GCTAACAAAGCTATGTCCCA 31666981-31667000(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA10 GCTGATGCCACTAAACATCA 31667207-31667226(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).