AP006222.2

Species: Homo sapiens

Position: chr1: 257863-264733

Known as:

Transcript: ENST00000442116

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 CACCCGAGGGTGGGTCACCA 264708-264727(-) gene body (near 5') 20 TGG CRISPRi Partial validated U87 NA [1]
sgRNA2 CTTTGGAGCGCCTGGTAGTG 264685-264704(-) gene body (near 5') 20 TGG CRISPRi Partial validated U87;iPSC NA [1]
sgRNA3 AAGACTGACCTGGGGAGATG 264626-264645(-) gene body (near 5') 20 TGG CRISPRi Partial validated U87;iPSC NA [1]
sgRNA4 TGAAACTCTGGTCTTCACTG 264654-264673(+) gene body (near 5') 20 TGG CRISPRi Partial validated U87;iPSC NA [1]
sgRNA5 CTCAGGACCCACCCGAGGGT 264717-264736(-) gene body (near 5') 20 GGG CRISPRi Partial validated U87;iPSC NA [1]
sgRNA6 TCTTAAGGACAATGAAACTC 264642-264661(+) gene body (near 5') 20 TGG CRISPRi Partial validated U87;iPSC NA [1]
sgRNA7 TGTGGACACACCACACTACC 264672-264691(+) gene body (near 5') 20 AGG CRISPRi Partial validated U87;iPSC NA [1]
sgRNA8 GCAGCCGAAGCCTCAAGGAA 264475-264494(+) gene body (near 5') 20 GGG CRISPRi Partial validated U87;iPSC NA [1]
sgRNA9 AGCCATGGTGACCCACCCTC 264703-264722(+) gene body (near 5') 20 GGG CRISPRi Partial validated U87;iPSC NA [1]
sgRNA10 ACAGCACACGGGGAGCAGAC 264566-264585(+) gene body (near 5') 20 AGG CRISPRi Partial validated U87;iPSC NA [1]
sgRNA11 CACCCGAGGGTGGGTCACCA 264708-264727(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).