Airn
Species: Mus musculus
Position: chr17: 1284-12860122
Known as: Airn , ENSMUSG00000078247
Transcript: NR_027773 , NR_027772 , NR_027784 , NR_002853 , ENSMUST00000161890 , ENSMUST00000079529 , ENSMUST00000160932 , ENSMUST00000162826
Sequence: Download
Description:
Airn, a lncRNA with diffience expression in two cell types: mouse ESCs, in which Airn is expressed at low levels, and mouse trophoblast stem cells (TSCs), in which Airn is more highly expressed and active. Under normal physiological conditions, the Airn lncRNA is monoallelically expressed due to a process called genomic imprinting that leads to methylation of its promoter and gene silencing specifically on the maternally inherited allele.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TGTAAGGCCATCTAAAACAC | 12741201-12741220(+) | gene body (near 3') | 20 | AGG | CRISPRi | Experimental validated | ESCs, TSCs | NA | [1] |
GBrowser
Links
Reference
1. Schertzer MD, Thulson E, Braceros KCA, Lee DM, Hinkle ER, et al. (2019). A piggyBac-based toolkit for inducible genome editing in mammalian cells. RNA 25(8): 1047-1058.
