BGLT3
Species: Homo sapiens
Position: chr11: 5244553-5245546
Known as: BGLT3 , ENSG00000260629
Transcript: NR_121648 , ENST00000564523
Sequence: Download
Description:
BGLT3, an erythroid lncRNA encoded downstream of r-globin (HBG1). BGLT3 and r-globin genes are dynamically co-transcribed in erythroid cells in vivo. Deletion of BGLT3 using CRISPR/Cas9 editing shows that it specifically contributes to regulation of r-globin genes. We used reduction or over-expression of the RNA and inhibition of transcription through the locus by CRISPRi to distinguish functions of the transcript versus the underlying sequence. Transcription of the BGLT3 locus is critical for looping between the r-globin genes and BGLT3 sequences. In contrast, the BGLT3 transcript is dispensable for r-globin/BGLT3 looping but interacts with the Mediator complex on chromatin. Manipulation of the BGLT3 locus does not compromise r-globin gene long-range looping interactions with the b-globin locus control region (LCR). These data reveal that BGLT3 regulates r-globin transcription in a developmental stage-specific fashion together with the LCR by serving as a separate means to increase RNA Pol II density at the r-globin promoters.
sgRNAs
sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
---|---|---|---|---|---|---|---|---|---|---|
sgRNA1 | TAGATTGTCTTTCGCTCTGA | 5246324-5246343(-) | up stream | 20 | TGG | CRISPRko;CRISPRi | Experimental validated | K562 | NA | [1] |
sgRNA2 | AGAACATCTAATAGTGTTGG | 5244691-5244710(+) | gene body (near 3') | 20 | GGG | CRISPRko | Experimental validated | K562 | NA | [1] |
GBrowser
Links
Reference
1. Ivaldi MS, Diaz LF, Chakalova L, Lee J, Krivega I, et al. (2018). Fetal γ-globin genes are regulated by the BGLT3 long non-coding RNA locus. Blood.