CASC9
Species: Homo sapiens
Position: chr8: 75223116-75324741
Known as: CASC9 , ENSG00000249395
Transcript: NR_103848 , NR_103849 , NR_103850 , ENST00000504531 , ENST00000522183 , ENST00000521147 , ENST00000523313
Sequence: Download
Description:
CASC9 modulates cell viability, proliferation, and apoptosis as well as tumor formation in vivo. CASC9 interacts with HNRNPL and shares a significant set of co-regulated target genes whose regulation leads to attenuation of AKT-signaling and induction of DNA damage signaling. Thus, the newly identified CASC9: HNRNPL complex plays a relevant role in hepato-carcinogenesis and may be considered for therapeutic interventions.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GCAGGATATAATCTCGTGGT | 75324543-75324562(-) | gene body (near 5') | 20 | GGG | CRISPRi;CRISPRa | High activity | HLE | less than 10% knockdown and a seven-to-ten fold overexpression | [1] |
| sgRNA2 | GGCGTAGGACCCTCTGAACC | 75324567-75324586(-) | gene body (near 5') | 20 | AGG | CRISPRi;CRISPRa | High activity | HLE | less than 10% knockdown and a seven-to-ten fold overexpression | [1] |
GBrowser
Links
Reference
1. Klingenberg M, Groß M, Goyal A, Polycarpou-Schwarz M, Miersch T, et al. (2018). The lncRNA CASC9 and RNA binding protein HNRNPL form a complex and co-regulate genes linked to AKT signaling. Hepatology.
