CR45242
Species: Drosophila melanogaster
Position: chr3L: 10269481-10270353
Known as:
Transcript: CR45242
Sequence: Download
Description:
We identified 128 testis-specific Drosophila lncRNAs and knocked out 105 of them using an optimized three-component CRISPR/Cas9 system. Among the lncRNA knockouts, 33 (31%) exhibited a partial or complete loss of male fertility, accompanied by visual developmental defects in late spermatogenesis. In addition, six knockouts were fully or partially rescued by transgenes in a trans configuration, indicating that those lncRNAs primarily work in trans. Furthermore, gene expression profiles for five lncRNA mutants revealed that testis-specific lncRNAs regulate global gene expression, orchestrating late male germ cell differentiation.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| gRNA1 | GGTCGCGTAAAGTGCTCCA | 10269506-10269524(+) | gene body (near 5') | 19 | AGG | CRISPRko | Homologous recombination efficiency: 6.45% | embryo | Knockout phenotype: no/minor phenotype | [1] |
| gRNA2 | GGACATCCGCAGTTGGGCGGT | 10270282-10270302(-) | gene body (near 3') | 21 | GGG | CRISPRko | Homologous recombination efficiency: 6.45% | embryo | Knockout phenotype: no/minor phenotype | [1] |
GBrowser
Links
Reference
1. Wen K, Yang L, Xiong T, Di C, Ma D, et al. (2016). Critical roles of long noncoding RNAs in Drosophila spermatogenesis. Genome Res 26(9): 1233-44.
