DGCR5

Species: Homo sapiens

Position: chr22: 18970524-19031242

Known as:

Transcript: ENST00000440005

Sequence: Download

Description:

We report a high throughput genomic deletion strategy to screen for functional long non-coding RNAs (lncRNAs) that is based on a lentiviral paired-guide RNA (pgRNA) library. Applying our screening method, we identified 51 lncRNAs that can positively or negatively regulate human cancer cell growth. We used the MAGeCK algorithm to identify the top hits by comparing samples from day 30 with day-0 controls. The output of MAGeCK is a set of negatively (or positively) selected lncRNAs, or lncRNAs whose knockout disrupts (or stimulates) cell proliferation. In total, MAGeCK identified 43 negatively selected and 8 positively selected lncRNAs with statistical significance (false discovery rate < 0.25).



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 CCGCCCCTCCTAGCCAGCTG 18974689-18974708(+) gene body (near 5') 20 AGG CRISPRko Partial validated Huh7.5 NA [1]
sgRNA2 CGGGTACCGAGAGTAGGTGG 18971037-18971056(+) gene body (near 5') 20 AGG CRISPRko Partial validated Huh7.5 NA [1]
sgRNA3 CTGGGTGTGAGGTCCCGCAG 18971339-18971358(+) gene body (near 5') 20 TGG CRISPRko Partial validated Huh7.5 NA [1]
sgRNA4 GGCGCCTGGATGCCGGCCCG 18970545-18970564(+) gene body (near 5') 20 GGG CRISPRko Partial validated Huh7.5 NA [1]
sgRNA5 GAGGTAACAGAGTGGCCCCG 18974266-18974285(+) gene body (near 5') 20 GGG CRISPRko Partial validated Huh7.5 NA [1]
sgRNA6 GCCCAGACATCCGCAGCCCG 18971227-18971246(+) gene body (near 5') 20 AGG CRISPRko Partial validated Huh7.5 NA [1]
sgRNA7 GAGGCAGTGATAGATGATGG 18972082-18972101(+) gene body (near 5') 20 TGG CRISPRko Partial validated Huh7.5 NA [1]
sgRNA8 GTGCCTCTTGGCTCTCCAGT 18975173-18975192(+) gene body (near 5') 20 CGG CRISPRko Partial validated Huh7.5 NA [1]
sgRNA9 CCCCATCTTACTGCAAGGCC 18965079-18965098(+) up stream 20 AGG CRISPRko Partial validated Huh7.5 NA [1]
sgRNA10 ATCAGGACCAGCTCGGGCAG 18965158-18965177(+) up stream 20 GGG CRISPRko Partial validated Huh7.5 NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Zhu S, Li W, Liu J, Chen CH, Liao Q, et al. (2016). Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nat Biotechnol 34(12): 1279-1286.