FAM226B

Species: Homo sapiens

Position: chrX: 72777607-72779097

Known as:

Transcript: ENST00000602508

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 AGTATGTCATCAAAAGGTAC 72777644-72777663(+) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 GAAGACGGTGGCGATCAAAA 72777609-72777628(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 GCTGGTTAAGAACCGGAAGA 72777594-72777613(+) gene body (near 5') 20 CGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 AGGCTTTCTTGAAAATCTCA 72777678-72777697(-) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 AGAACCCAAAGACTAACTCG 72777708-72777727(-) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 GGTTAAGAACCGGAAGACGG 72777597-72777616(+) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 GACTAACTCGGGGAGGTCAG 72777698-72777717(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 CTTTCTTGAAAATCTCAGGG 72777675-72777694(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 GCCTGTCAGGCCCCAAACCA 72777791-72777810(-) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA10 AGTACCTGCTGGTTAAGAAC 72777587-72777606(+) up stream 20 CGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).