GAS5

Species: Homo sapiens

Position: chr1: 173863898-173868882

Known as: GAS5 , ENSG00000234741

Transcript: NR_152521 , NR_152527 , NR_152529 , NR_152534 , NR_152522 , NR_152523 , NR_152530 , NR_152526 , NR_152528 , NR_152524 , NR_152533 , NR_002578 , NR_152525 , NR_152531 , NR_152532 , ENST00000451607 , ENST00000432536 , ENST00000430245 , ENST00000454068 , ENST00000450589 , ENST00000448718 , ENST00000449289 , ENST00000452197 , ENST00000414075 , ENST00000425771

Sequence: Download

Description:

GAS5 is necessary and sufficient for growth arrest in human peripheral blood T-cells, and could functions by controlling apoptosis and the cell cycle in lymphocytes. In some cell lines, certain Gas5 isoforms act to sensitise the cells to apoptosis but can't induce apoptosis on their own. In other cells types Gas5 can both induce apoptosis and growth arrest and sensitise the cells to further apoptosis. Gas5 can be regulated by mTOR, with mTOR (which promotes cellular proliferation) acting to inhibit the function of Gas5. Gas5 carries out its function by binding the DNA binding domain of the glucocorticoid receptor (GR) with a sequence that mimmics the glucocorticoid response element (GRE). Gas5 is translocated into the nucleus bound to the GR where it prevents GR from binding GREs and regulating transcription of target genes including apoptosis inhibitors.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 GCGCTCCAGCCTTTGTCTGCTA 173867902-173867923(-) gene body (near 5') 22 AGG CRISPRi Experimental validated K562 NA [1]
sgRNA2 GTTTTATCTTTGCGAATGTTG 173867935-173867955(-) gene body (near 5') 21 CGG CRISPRi Experimental validated K562 NA [1]
sgRNA3 GGTGACCTTAGCAGACAAAGGC 173867894-173867915(+) gene body (near 5') 22 TGG CRISPRi Experimental validated K562 NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, et al. (2014). Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell 159(3): 647-61.