Gm15441
Species: Mus musculus
Position: chr3: 96555767-96566801
Known as: Gm15441 , ENSMUSG00000074398
Transcript: NR_040409 , ENSMUST00000107095
Sequence: Download
Description:
Gm15441 as a liver-enriched transcript, whose expression is strongly altered upon metabolic disease and in response to short-term calorie restriction. The genomic locus of lncRNA Gm15441 is located on murine chromosome 3 (chr3: 96,555,765-96,566,801), yet overlaps with the protein-coding gene Txnip, a well-studied modulator of energy metabolism.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GGCCTTGGCTCACTAGGTGA | 96566550-96566569(+) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | NSC-34 | paried with sgRNA2 | [1] |
| sgRNA2 | TTCCCAGATGACTTTAGTTG | 96566957-96566976(+) | up stream | 20 | GGG | CRISPRko | Experimental validated | NSC-34 | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Hansmeier NR, Widdershooven PJM, Khani S, Kornfeld JW (2019). Rapid Generation of Long Noncoding RNA Knockout Mice Using CRISPR/Cas9 Technology. Noncoding RNA 5(1).
