H19
Species: Homo sapiens
Position: chr11: 1995175-2001470
Known as: H19 , ENSG00000130600
Transcript: NR_002196 , NR_131223 , NR_131224 , ENST00000414790 , ENST00000412788 , ENST00000428066
Sequence: Download
Description:
H19 is a multifunctional and well-characterized lncRNA with activity in the nucleus and in the cytoplasm. H19 appears to be a bi-functional RNA acting as both a miRNA and a lncRNA,or as both a tumor suppressor and an oncogene upregulated by c-myc and hypoxia. H19 knockout showes an overgrowth phenotype due in part to bi-allelic expression of Igf2. H19 can also function in trans to downregulate the expression of a number of imprinted genes in the hypothesized Imprinted Gene Network (IGN) including Igf2r, Dlk1 etc., which allows H19 to regulate growth during development. In gilbert et al. work and Stojic et al. work, H19 was used as a prototypical lncRNA to investigat the CRISPRi capability to repress lncRNA transcription or to test the different biological conclusions between loss-of-function (LOF) methods, respectively. Transducing the sgRNAs into cells expressing dCas9-KRAB yielded >85% knockdown. However, Knockdown of H19 had 5 and 29 DEGs in clonal and non-clonal populations, hinting the presence of compensatory mechanisms in clonal cells that may be countering dCas9-KRAB activity, possibly due to changes in the transcriptional background.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GGGGGGTAACGGGGGAAACT | 1997797-1997816(-) | gene body (near 3') | 20 | GGG | CRISPRi | High activity | K562 | yielded >85% knockdown | [1] |
| sgRNA2 | GCTAGGACCGAGGAGCAGGGTG | 1997837-1997858(-) | gene body (near 3') | 22 | AGG | CRISPRi | High activity | Hela;K562 | yielded >85% knockdown | [2] [1] |
GBrowser
Links
Reference
1. Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, et al. (2014). Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell 159(3): 647-61.
2. Stojic L, Lun ATL, Mangei J, Mascalchi P, Quarantotti V, et al. (2018). Specificity of RNAi, LNA and CRISPRi as loss-of-function methods in transcriptional analysis. Nucleic Acids Res.