HBL1
Species: Homo sapiens
Position: chr13: 54113636-54116706
Known as:
Transcript: HBL1
Sequence: Download
Description:
HBL1 (Heart Brake LncRNA 1), a human-specific long noncoding RNA, regulates cardiomyocyte development from human induced pluripotent stem cells (hiPSCs). Overexpression of HBL1 repressed, whereas knockdown and knockout of HBL1 increased, cardiomyocyte differentiation from hiPSCs. HBL1 physically interacted with MIR1 in an AGO2 complex. Disruption of MIR1 binding sites in HBL1 showed an effect similar to that of HBL1 knockout. SOX2 bound to HBL1 promoter and activated its transcription. Knockdown of SOX2 in hiPSCs led to decreased HBL1 expression and increased cardiomyocyte differentiation efficiency. Thus, HBL1 plays a modulatory role in fine-tuning human-specific cardiomyocyte development by forming a regulatory network with SOX2 and MIR1.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | CTAGCTTGAAGATGCCAAC | 54116525-54116543(-) | gene body (near 5') | 19 | AGG | CRISPRko | Experimental validated | iPSC | paried with sgRNA2 | [1] |
| sgRNA2 | TAGAGTAGTTCAATCAATAC | 54113725-54113744(-) | gene body (near 3') | 20 | TGG | CRISPRko | Experimental validated | iPSC | paried with sgRNA1 | [1] |
| sgRNA3 | ACTTTGAAATTAACTTGATT | 54115498-54115517(+) | gene body (near 5') | 20 | TGG | CRISPRi | Experimental validated | iPSC | NA | [1] |
| sgRNA4 | AATCCCCTGGGATGCAGGAA | 54115427-54115446(+) | gene body (near 5') | 20 | TGG | CRISPRi | Experimental validated | iPSC | NA | [1] |
GBrowser
Links
Reference
1. Liu J, Li Y, Lin B, Sheng Y, Yang L (2017). HBL1 Is a Human Long Noncoding RNA that Modulates Cardiomyocyte Development from Pluripotent Stem Cells by Counteracting MIR1. Dev Cell 42(4): 333-348.e5.
