HNRNPU-AS1

Species: Homo sapiens

Position: chr1: 244840637-244854748

Known as:

Transcript: ENST00000366527

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 CTGGAGGTTCCAGGTGGTCA 244846610-244846629(-) gene body (near 3') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 GTGTGAAAGTCTGGATAGAG 244846553-244846572(-) gene body (near 3') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 CAATGAAGGAAGCTGTACAC 244846629-244846648(-) gene body (near 3') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 ACACTAGGTGATATAGCAGT 244846670-244846689(+) gene body (near 3') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 AAAATTAACTAGCTCTTCTC 244846889-244846908(+) gene body (near 3') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 CATCTCAGTAAAAGGACCTC 244846860-244846879(+) gene body (near 3') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 CGGAATTAATGGAACAATGA 244846643-244846662(-) gene body (near 3') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 TGTACACTGGAGGTTCCAGG 244846616-244846635(-) gene body (near 3') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 GTAGTCTTAAAAACTTCTTG 244846734-244846753(+) gene body (near 3') 20 TGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).