HOTAIR
Species: Homo sapiens
Position: chr12: 53962307-53974956
Known as: HOTAIR , ENSG00000228630
Transcript: NR_003716 , NR_047517 , NR_047518 , ENST00000424518 , ENST00000455246 , ENST00000439545
Sequence: Download
Description:
HOTAIR acts as a scaffold for protein complexes. A 5' domain binds PRC2 while a 3' domain binds LSD1. HOTAIR dysregulated in breast cancer with frequent overexpression in metastases. Overexpression of HOTAIR leads to PRC2 re-targeting across the genome to a state similar to that in embryonic fibroblasts, promoting tumour invasion and metatasis. Oncogenic effects of HOTAIR upregulation were dependent on PRC2. Deletion of the HoxC cluster containing the cognate Hotair transcript in mouse showed little phenotypic effect, with little change in the expression on levels of H3K27me3 coverage in corresponding human HOTAIR Hoxd target genes.
HOTAIR is a well-studied lncRNA which arises from the HOXC locus and regulates transcription of several genes by mediating chromatin modifcations. One of the variants of HOTAIR arises from the HOXC11 intron, ~1.8 kb downstream of its TSS. dCas9-KRAB-mediated targeting using three independent sgRNAs but not siPOOL-mediated knockdown of HOTAIR resulted in simultaneous knockdown of HOXC11.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GGGCCGCCCTCCTAGTGGTT | 53974819-53974838(-) | gene body (near 5') | 20 | CGG | CRISPRi | Experimental validated | Hela | NA | [1] |
| sgRNA2 | GAGGGGACGCACGTGTACC | 53974880-53974898(+) | gene body (near 5') | 19 | TGG | CRISPRi | Experimental validated | Hela | NA | [1] |
| sgRNA3 | GCGGCTCTCGCCTGAGAAC | 53974935-53974953(+) | gene body (near 5') | 19 | TGG | CRISPRi | Experimental validated | Hela | NA | [1] |
| sgRNA4 | ACCGAGGGAGATAACGGGGG | 53974184-53974203(-) | gene body (near 5') | 20 | AGG | CRISPRko | Partial validated | Huh7.5 | paried with sgRNA5 | [2] |
| sgRNA5 | GAGGGGGCAAGTGCGAGGAG | 53975149-53975168(-) | up stream | 20 | AGG | CRISPRko | Partial validated | Huh7.5 | paried with sgRNA4,6,7,10,11 | [2] |
| sgRNA6 | CTGGCGCCCCGGGAAGCCCG | 53974656-53974675(-) | gene body (near 5') | 20 | CGG | CRISPRko | Partial validated | Huh7.5 | paried with sgRNA5 | [2] |
| sgRNA7 | GACCCCCGCCTGGAACGCAG | 53974568-53974587(-) | gene body (near 5') | 20 | TGG | CRISPRko | Partial validated | Huh7.5 | paried with sgRNA5 | [2] |
| sgRNA8 | CAGACCGAGGGAGATAACGG | 53974187-53974206(-) | gene body (near 5') | 20 | GGG | CRISPRko | Partial validated | Huh7.5 | paried with sgRNA9 | [2] |
| sgRNA9 | CCAGCCCGCTGAGCGCTCAG | 53975095-53975114(-) | up stream | 20 | CGG | CRISPRko | Partial validated | Huh7.5 | paried with sgRNA8,11 | [2] |
| sgRNA10 | ATCTGGCGAGAGCAGTCGGG | 53974734-53974753(-) | gene body (near 5') | 20 | AGG | CRISPRko | Partial validated | Huh7.5 | paried with sgRNA5 | [2] |
| sgRNA11 | AGTCGAGTCGTTGGGAGAGA | 53974096-53974115(-) | gene body (near 5') | 20 | GGG | CRISPRko | Partial validated | Huh7.5 | paried with sgRNA5,9 | [2] |
GBrowser
Links
Reference
1. Goyal A, Myacheva K, Groß M, Klingenberg M, Duran Arqué B, et al. (2017). Challenges of CRISPR/Cas9 applications for long non-coding RNA genes. Nucleic Acids Res 45(3): e12.
2. Zhu S, Li W, Liu J, Chen CH, Liao Q, et al. (2016). Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nat Biotechnol 34(12): 1279-1286.