Hand2os1
Species: Mus musculus
Position: chr8: 57304260-57320859
Known as: Hand2os1 , ENSMUSG00000100510
Transcript: NR_110474 , NR_154048
Sequence: Download
Description:
The lncRNA Hand2os1 (also named Uph or lncHand2) is divergently positioned at ?123 bp upstream of the transcription start site (TSS) of HAND2. Full-length deletion of Hand2os1 led to congenital heart defects and perinatal lethality. Importantly, in embryos lacking the entire Hand2os1 DNA sequence, single cell transcriptomic analysis of the heart revealed subtle yet prevalent upregulation of HAND2 and dysregulated cardiac gene expression programs. These results illustrate a crucial, fine-tuning function of the lncRNA Hand2os1 locus in accurately controlling the spatial expression of HAND2, through which Hand2os1 modulates cardiac lineage development and heart function.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | ACGCCAATCCCGGGGCGGCG | 57320916-57320935(-) | up stream | 20 | GGG | CRISPRko | Experimental validated | embryo | paried with sgRNA2, sgRNA5 | [1] |
| sgRNA2 | TTGTAAGTTAGCGGGCCTCG | 57319915-57319934(-) | gene body (near 5') | 20 | GGG | CRISPRko | Experimental validated | embryo | paried with sgRNA1 | [1] |
| sgRNA3 | GGGTAAGAAGAGGAAGAATC | 57307881-57307900(-) | gene body (near 3') | 20 | TGG | CRISPRko | Experimental validated | embryo | paried with sgRNA4 | [1] |
| sgRNA4 | GGGCGTGACTGTGTGAGAGG | 57305166-57305185(-) | gene body (near 3') | 20 | GGG | CRISPRko | Experimental validated | embryo | paried with sgRNA3 | [1] |
| sgRNA5 | GTTGCTGCTGGCTTAAGTAG | 57303818-57303837(-) | down stream | 20 | GGG | CRISPRko | Experimental validated | embryo | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Han X, Zhang J, Liu Y, Fan X, Ai S, et al. (2019). The lncRNA Hand2os1/Uph locus orchestrates heart development through regulation of precise expression of Hand2. Development 146(13).
