Haunt
Species: Mus musculus
Position: chr6: 52102948-52113684
Known as: Halr1 , ENSMUSG00000085412
Transcript: NR_110440 , ENSMUST00000189071 , ENSMUST00000155758 , ENSMUST00000125374
Sequence: Download
Description:
In Liu et al. work, Haunt is highly expressed in mESCs and its expression is maintained by OCT4. Haunt represses Hoxa gene expression by recruiting PRC2 to the cluster and maintaining the H3K27me3 modification on Hoxa promoters. A chromosome conformation capture assay revealed the close physical association of the Haunt locus to multiple sites at the Hoxa gene cluster in mESCs, which may facilitate the in cis targeting of Haunt RNA to the Hoxa genes. Furthermore, an OCT4-responsive positive cis-regulatory element is found in the Haunt gene locus, which potentially regulates both Haunt itself and the Hoxa gene activation. This study suggests how PRC2 is recruited to the Hoxa locus in mESCs, and implies an elaborate mechanism for Hoxa gene regulation in mESCs.
In Yin et al. work, they demonstrate discrete and opposing roles for the lncRNA transcript Haunt and its genomic locus in regulating the HOXA gene cluster during ESC differentiation. Reducing or enhancing Haunt expression, with minimal disruption of the Haunt locus, led to upregulation or downregulation of HOXA genes, respectively. In contrast, increasingly large genomic deletions within the Haunt locus attenuated HOXA activation. The Haunt DNA locus contains potential enhancers of HOXA activation, whereas Haunt RNA acts to prevent aberrant HOXA expression. This work reveals a multifaceted model of lncRNA-mediated transcriptional regulation of the HOXA cluster, with distinct roles for a lncRNA transcript and its genomic locus, while illustrating the power of rapid CRISPR/Cas9-based genome editing for assigning lncRNA functions.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TAGAGGAACAATTGCTGCAT | 52105900-52105919(-) | gene body (near 5') | 20 | TGG | CRISPRko | High activity | ESCs;JM8A3 | the most effective sgRNAs of this study,paried with sgRNA2 | [1] |
| sgRNA2 | CTTTGAAAAGAAGTGAAGGA | 52107731-52107750(-) | gene body (near 5') | 20 | AGG | CRISPRko | High activity | ESCs;JM8A3 | the most effective sgRNAs of this study,paried with sgRNA1 | [1] |
| sgRNA3 | GATGCATGCCTGGCTCTTCC | 52102884-52102903(+) | up stream | 20 | TGG | CRISPRki | Experimental validated | ESCs | NA | [2] |
| sgRNA4 | GGCAGTGTGTACCGAGGCTT | 52101384-52101403(-) | up stream | 20 | TGG | CRISPRko | Experimental validated | ESCs | NA | [2] |
| sgRNA5 | GGCTAGAACTACATTTTTAC | 52101644-52101663(+) | up stream | 20 | AGG | CRISPRko | Experimental validated | ESCs | NA | [2] |
| sgRNA6 | GGAGACACGGCGCTATGCGA | 52101979-52101998(-) | up stream | 20 | TGG | CRISPRko | Experimental validated | ESCs | NA | [2] |
| sgRNA7 | GGAAGGGTGCAAAGGAAGGG | 52102462-52102481(+) | up stream | 20 | TGG | CRISPRko | Experimental validated | ESCs | NA | [2] |
| sgRNA8 | GGTTGTATCACCTCCGCCCA | 52102958-52102977(-) | gene body (near 5') | 20 | CGG | CRISPRko;CRISPRki | Experimental validated | ESCs | NA | [2] |
| sgRNA9 | GGACCGTCTCTCCAGATGCA | 52103691-52103710(+) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | ESCs | NA | [2] |
| sgRNA10 | GCTATTTACAGTGAAGACAC | 52108736-52108755(+) | gene body (near 3') | 20 | TGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA4 | [2] |
| sgRNA11 | GCTTGAAATTGGGACAGGCA | 52111549-52111568(+) | gene body (near 3') | 20 | AGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA12 | [2] |
| sgRNA12 | GCTACTGTGAGTGCTCACTG | 52119462-52119481(+) | down stream | 20 | CGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA11 | [2] |
| sgRNA13 | GTAGGAATGAAGAGAACATT | 52132158-52132177(-) | down stream | 20 | AGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA14 | [2] |
| sgRNA14 | GGTCACTTTTCAACCCCACA | 52074048-52074067(-) | up stream | 20 | GGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA13 | [2] |
| sgRNA15 | TTGTCTCCTCCAGAGTCACT | 52111867-52111886(+) | gene body (near 3') | 20 | TGG | CRISPRki | Experimental validated | ESCs | NA | [2] |
GBrowser
Links
Reference
1. Liu GY, Zhao GN, Chen XF, Hao DL, Zhao X, et al. (2016). The long noncoding RNA Gm15055 represses Hoxa gene expression by recruiting PRC2 to the gene cluster. Nucleic Acids Res 44(6): 2613-27.
2. Yin Y, Yan P, Lu J, Song G, Zhu Y, et al. (2015). Opposing Roles for the lncRNA Haunt and Its Genomic Locus in Regulating HOXA Gene Activation during Embryonic Stem Cell Differentiation. Cell Stem Cell 16(5): 504-16.