Hottip

Species: Mus musculus

Position: chr6: 52262774-52267603

Known as: Hottip , ENSMUSG00000055408

Transcript: NR_110441 , NR_110442 , ENSMUST00000141300 , ENSMUST00000152875

Sequence: Download

Description:

Hottip expression is required for activation of the 5' Hoxa genes (Hoxa13 and Hoxa10/11) and for retaining Mll1 at the 5' end of Hoxa. Moreover, we demonstrate that artificially inducing Hottip expression is sufficient to activate the 5' Hoxa genes and that Hottip RNA binds to the 5' end of Hoxa. By engineering premature transcription termination, we show that it is the Hottip lncRNA molecule itself, not just Hottip transcription that is required to maintain active expression of posterior Hox genes. Our data show a direct role for a lncRNA molecule in regulating the expression of developmentally-regulated mRNA genes in cis.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 CTCCGAGAGTCTCCGAGAAT 52262822-52262841(-) gene body (near 5') 20 TGG CRISPRko;CRISPRki Experimental validated ESCs;14fp NA [1]
sgRNA2 CTCGAGGGCAGTTTACATAC 52262843-52262862(+) gene body (near 5') 20 AGG CRISPRko Experimental validated ESCs;14fp NA [1]
sgRNA3 GGCCCACTTACTCAGTTTCC 52266844-52266863(-) gene body (near 3') 20 AGG CRISPRko Experimental validated ESCs;14fp NA [1]
sgRNA4 CACTCCCTCCCGCTTTGTAC 52266887-52266906(+) gene body (near 3') 20 AGG CRISPRko Experimental validated ESCs;14fp NA [1]
sgRNA5 GCAGTAAGAAGGTAAACTCG 52262646-52262665(-) up stream 20 GGG CRISPRa Experimental validated ESCs;14fp NA [1]
sgRNA6 TCTCCTGACTTTAGCGGTCC 52262605-52262624(+) up stream 20 TGG CRISPRa Experimental validated ESCs;14fp NA [1]
sgRNA7 TACCCAGGACCGCTAAAGTC 52262611-52262630(-) up stream 20 AGG CRISPRa Experimental validated ESCs;14fp NA [1]
sgRNA8 GGATCAGGGAAGGTTTTATT 52262547-52262566(-) up stream 20 GGG CRISPRa Experimental validated ESCs;14fp NA [1]
sgRNA9 GGGATCAGGGAAGGTTTTAT 52262548-52262567(-) up stream 20 TGG CRISPRa Experimental validated ESCs;14fp NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Pradeepa MM, McKenna F, Taylor GC, Bengani H, Grimes GR, et al. (2017). Psip1/p52 regulates posterior Hoxa genes through activation of lncRNA Hottip. PLoS Genet 13(4): e1006677.