HoxBlinc
Species: Mus musculus
Position: chr11: 96315617-96318199
Known as:
Transcript: HoxBlinc
Sequence: Download
Description:
HoxBlinc RNA first specifies Flk1+ mesoderm and then promotes hematopoietic differentiation through regulating hoxb gene pathways. HoxBlinc binds to the hoxb genes, recruits Setd1a/MLL1 complexes, and mediates long-range chromatin interactions to activate transcription of the hoxb genes. HoxBlinc plays an important role in controlling hoxb transcription networks that mediate specification of mesoderm-derived Flk1+ precursors and differentiation of Flk1+ cells into hematopoietic lineages.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TTGCTATGCTCAACGCGCTT | 96314926-96314945(+) | up stream | 20 | GGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA2 | [1] |
| sgRNA2 | ATGCGCCACCGAAAGTCGCG | 96316908-96316927(+) | gene body (near 3') | 20 | CGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Deng C, Li Y, Zhou L, Cho J, Patel B, et al. (2016). HoxBlinc RNA Recruits Set1/MLL Complexes to Activate Hox Gene Expression Patterns and Mesoderm Lineage Development. Cell Rep 14(1): 103-114.
