Hoxb3os
Species: Mus musculus
Position: chr11: 96343032-96354691
Known as: Hoxb3os , ENSMUSG00000084844
Transcript: XR_001780306 , XR_001780307 , XR_001780308 , XR_001780309 , XR_001780310 , XR_001780311 , ENSMUST00000131275 , ENSMUST00000147410
Sequence: Download
Description:
A kidney-specific, evolutionarily conserved lncRNA called Hoxb3os was downregulated in cystic kidneys from Pkd1 and Pkd2 mutant mice. The human ortholog HOXB3-AS1 was downregulated in cystic kidneys from ADPKD (Autosomal dominant polycystic kidney disease) patients. Hoxb3os was highly expressed in renal tubules in adult wild-type mice, whereas its expression was lost in the cyst epithelium of mutant mice. Deletion of Hoxb3os resulted in increased phosphorylation of mTOR and its downstream targets, including p70 S6 kinase, ribosomal protein S6, and the translation repressor 4E-BP1. Consistent with activation of mTORC1 signaling, Hoxb3os mutant cells displayed increased mitochondrial respiration. The Hoxb3os mutant phenotype was partially rescued upon re-expression of Hoxb3os in knockout cells. These findings identify Hoxb3os as a novel lncRNA that is downregulated in ADPKD and regulates mTOR signaling and mitochondrial respiration.
sgRNAs
sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
---|---|---|---|---|---|---|---|---|---|---|
sgRNA1 | AAGGTGATTCTGGGAGATCT | 96350219-96350238(-) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | mIMCD3 | paried with sgRNA2 | [1] |
sgRNA2 | ACTGCTCTTAACTAGGCCAG | 96349863-96349882(-) | gene body (near 5') | 20 | CGG | CRISPRko | Experimental validated | mIMCD3 | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Aboudehen K, Farahani S, Kanchwala M, Chan SC, Avdulov S, et al. (2018). Long noncoding RNA Hoxb3os is dysregulated in autosomal dominant polycystic kidney disease and regulates mTOR signaling. J Biol Chem.