HypERlnc
Species: Homo sapiens
Position: chr16: 14301388-14331067
Known as: ENSG00000262454
Transcript: ENST00000641433 , ENST00000570945 , ENST00000634265
Sequence: Download
Description:
HypERlnc (Hypoxia-induced Endoplasmic Reticulum Stress Regulating lncRNA) is induced by hypoxia and expressed in the nucleus and cytosol of human pericytes (hPCs). HypERlnc signifcantly regulates human pericyte function, differentiation, and survival by modulating the endoplasmic reticulum (ER) stress response. HypERlnc knockdown results in pericyte dedifferentiation and induces endoplasmic reticulum stress that, in turn, significantly lowered HypERlnc levels and induced pericyte dedifferentiation. The data on ER stress as well as gene ontology and Kyoto Encyclopedia of Genes analyses in HypERlnc knockdown and reduced expression of HypERlnc in human HF samples corroborate a potential role of HypERlnc in cardiac disease. Furthermore, the clinical relevance of HypERlnc is supported by findings that HypERlnc significantly correlates with pericyte marker expression in disease states that go along with altered pericyte and vascular smooth muscle cell function such as idiopathic pulmonary arterial hypertension.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. | 
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | CAAATATAGTCAGCGGATAG | 14301963-14301982(-) | gene body (near 5') | 20 | GGG | CRISPRa | Experimental validated | hPC-PL | NA | [1] | 
| sgRNA2 | GCCAAATATAGTCAGCGGAT | 14301965-14301984(-) | gene body (near 5') | 20 | AGG | CRISPRa | Experimental validated | hPC-PL | NA | [1] | 
| sgRNA3 | CAGGAGAATCGCCTACACCT | 14300729-14300748(+) | up stream | 20 | GGG | CRISPRa | Experimental validated | hPC-PL | NA | [1] | 
| sgRNA4 | GCAGGAGAATCGCCTACACC | 14300728-14300747(+) | up stream | 20 | TGG | CRISPRa | Experimental validated | hPC-PL | NA | [1] | 
| sgRNA5 | ATGTGCTTAGGTCTCGGGGT | 14300289-14300308(+) | up stream | 20 | GGG | CRISPRa | Experimental validated | hPC-PL | NA | [1] | 
| sgRNA6 | CTAGCCTCAGTCTTTCGATC | 14300233-14300252(+) | up stream | 20 | TGG | CRISPRa | Experimental validated | hPC-PL | NA | [1] | 
| sgRNA7 | TGAGCACTTCGCTGCCGTTA | 14299739-14299758(-) | up stream | 20 | TGG | CRISPRa | Experimental validated | hPC-PL | NA | [1] | 
| sgRNA8 | CTTGAGGAACTAGACGTCTC | 14299782-14299801(-) | up stream | 20 | AGG | CRISPRa | Experimental validated | hPC-PL | NA | [1] | 
GBrowser
Links
Reference
1. Bischoff FC, Werner A, John D, Boeckel JN, Melissari MT, et al. (2017). Identification and Functional Characterization of Hypoxia-Induced Endoplasmic Reticulum Stress Regulating lncRNA (HypERlnc) in Pericytes. Circ Res 121(4): 368-375.
                    
                    
                







