IFNG-AS1
Species: Homo sapiens
Position: chr12: 67989444-68234686
Known as: IFNG-AS1 , ENSG00000255733
Transcript: NR_104124 , NR_104125 , ENST00000674322 , ENST00000538665 , ENST00000541715 , ENST00000536914
Sequence: Download
Description:
IFNG-AS1 is an lncRNA associated with inflammatory bowel disease, that has been seen to regulate Interferon Gamma. The IFNG-AS1 gene contains three splice variants that all use the same transcriptional start site.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | AGGCCTTGCAAAATGCTCAT | 67989262-67989281(+) | up stream | 20 | AGG | CRISPRa | Experimental validated | Jurkat T | NA | [1] |
| sgRNA2 | CTGCAAAACGTGAGCCCAAC | 67989415-67989434(+) | up stream | 20 | AGG | CRISPRa | Experimental validated | Jurkat T | NA | [1] |
| sgRNA3 | ATGCTCATAGGTGGAACAGC | 67989274-67989293(+) | up stream | 20 | AGG | CRISPRa | Experimental validated | Jurkat T | NA | [1] |
| sgRNA4 | TTCCAAATAATCCTGCCATT | 67989210-67989229(+) | up stream | 20 | CGG | CRISPRa | Experimental validated | Jurkat T | NA | [1] |
GBrowser
Links
Reference
1. Rankin CR, Treger J, Faure-Kumar E, Benhammou J, Anisman-Posner D, et al. (2019). Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR. J Vis Exp.
