IRAIN

Species: Homo sapiens

Position: chr15: 98645862-98651221

Known as: IRAIN , ENSG00000259424

Transcript: NR_126453 , ENST00000560221

Sequence: Download

Description:

IRAIN was expressed in a monoallelic manner, with the expression of the lncRNA exclusively from the paternal chromosome, and it appeared to serve as a tumor suppressor in hematopoietic tumors. IRAIN was also aberrantly regulated in breast cancer, exhibiting a pattern of allele-switch: the allele expressed in normal tissues was suppressed, while the normally silenced allele was expressed. Recent studies have shown that this lncRNA is also dysregulated in non-small-cell lung cancer and pancreatic cancer.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 GCCCCAGTCCGCGTCCCACT 98651309-98651328(-) up stream 20 CGG CRISPRki Experimental validated MDA-MB-231 NA [1]
sgRNA2 CATTTCTTACCAGACGTTTA 98651241-98651260(-) up stream 20 AGG CRISPRki Experimental validated MDA-MB-231 NA [1]
sgRNA3 CCACCTAAACGACTTAGTAA 98651415-98651434(-) up stream 20 AGG CRISPRki Experimental validated MDA-MB-231 NA [1]
sgRNA4 GCCCAGATCTGTGGAAGGTC 98651331-98651350(-) up stream 20 CGG CRISPRki Experimental validated MDA-MB-231 NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Pian L, Wen X, Kang L, Li Z, Nie Y, et al. (2018). Targeting the IGF1R Pathway in Breast Cancer Using Antisense lncRNA-Mediated Promoter cis Competition. Mol Ther Nucleic Acids 12: 105-117.