IRAIN
Species: Homo sapiens
Position: chr15: 98645862-98651221
Known as: IRAIN , ENSG00000259424
Transcript: NR_126453 , ENST00000560221
Sequence: Download
Description:
IRAIN was expressed in a monoallelic manner, with the expression of the lncRNA exclusively from the paternal chromosome, and it appeared to serve as a tumor suppressor in hematopoietic tumors. IRAIN was also aberrantly regulated in breast cancer, exhibiting a pattern of allele-switch: the allele expressed in normal tissues was suppressed, while the normally silenced allele was expressed. Recent studies have shown that this lncRNA is also dysregulated in non-small-cell lung cancer and pancreatic cancer.
sgRNAs
sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
---|---|---|---|---|---|---|---|---|---|---|
sgRNA1 | GCCCCAGTCCGCGTCCCACT | 98651309-98651328(-) | up stream | 20 | CGG | CRISPRki | Experimental validated | MDA-MB-231 | NA | [1] |
sgRNA2 | CATTTCTTACCAGACGTTTA | 98651241-98651260(-) | up stream | 20 | AGG | CRISPRki | Experimental validated | MDA-MB-231 | NA | [1] |
sgRNA3 | CCACCTAAACGACTTAGTAA | 98651415-98651434(-) | up stream | 20 | AGG | CRISPRki | Experimental validated | MDA-MB-231 | NA | [1] |
sgRNA4 | GCCCAGATCTGTGGAAGGTC | 98651331-98651350(-) | up stream | 20 | CGG | CRISPRki | Experimental validated | MDA-MB-231 | NA | [1] |
GBrowser
Links
Reference
1. Pian L, Wen X, Kang L, Li Z, Nie Y, et al. (2018). Targeting the IGF1R Pathway in Breast Cancer Using Antisense lncRNA-Mediated Promoter cis Competition. Mol Ther Nucleic Acids 12: 105-117.