LDAIR
Species: Oryzias latipes
Position: chr17: 29451315-29454189
Known as: LOC105356286
Transcript: XR_002292246 , XR_910490
Sequence: Download
Description:
LDAIR, whose robust rhythmic expression was induced only under long-day conditions. Transcriptome analysis of LDAIR knockout fish reveals differential expression of a number of genes close to the LDAIR locus, including corticotropin releasing hormone receptor 2 (CRHR2), which is known to be involved in the stress response. Behavioural analysis of LDAIR knockout medaka suggests that LDAIR affects stress-associated protective behaviours. These results indicate that photoperiodic regulation of CRHR2 by the LDAIR locus may modulate risk sensitivity and increase animal fitness to changing environments.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | ATTTTCTAGAAATTTAGACC | 29451809-29451828(-) | gene body (near 3') | 20 | TGG | CRISPRko | Experimental validated | embryo | paried with sgRNA2 | [1] |
| sgRNA2 | ACACTTGTACAACCATGTAG | 29453273-29453292(-) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | embryo | paried with sgRNA1 | [1] |
GBrowser
Links
Reference
1. Nakayama T, Shimmura T, Shinomiya A, Okimura K, Takehana Y, et al. (2019). Seasonal regulation of the lncRNA LDAIR modulates self-protective behaviours during the breeding season. Nat Ecol Evol 3(5): 845-852.
