LINC01004

Species: Homo sapiens

Position: chr7: 105013424-105014321

Known as:

Transcript: ENST00000453677

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 CGGAGACCGTGCCGGAGTTC 105014248-105014267(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 GGCCGAGTCGGAGACCGTGC 105014240-105014259(+) gene body (near 5') 20 CGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 CAACAGGAACGCAGAGACGA 105014314-105014333(-) gene body (near 5') 20 CGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 GCGGCAGCCCACAAGCAAAA 105014063-105014082(+) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 TTCGGGAGCGGCAACAGAGT 105014265-105014284(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 TGACACTGAGCGGGCGCAGG 105014219-105014238(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 ACGCCCGTCCCGCTCCGCAG 105014119-105014138(-) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 CTGTTGCCGCTCCCGAACTC 105014262-105014281(-) gene body (near 5') 20 CGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 ACCGTGCCGGAGTTCGGGAG 105014253-105014272(+) gene body (near 5') 20 CGG CRISPRi Partial validated iPSC NA [1]
sgRNA10 CTCCGGCACGGTCTCCGACT 105014245-105014264(-) gene body (near 5') 20 CGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).