LINC01021
Species: Homo sapiens
Position: chr5: 27472291-27496401
Known as: PURPL , ENSG00000250337
Transcript: NR_038848 , ENST00000512067 , ENST00000510165 , ENST00000505775
Sequence: Download
Description:
LINC01021 (also designated LOC643401 or RP11-46C20.1) is a direct p53 target when p53 mediates response to DNA damage, and its expression is highly dependent on p53 in colorectal cancer (CRC) cell lines. By CRISPR/Cas9-mediated deletion of the MER61C LTR (an ERV1-derived LTR) in which the LINC01021 promoter and the p53 binding site lie, transcription of LINC01021 in p53-proficient colorectal cancer cells was ablated, resulting in hypersensitivity towards chemotherapeutic treatments. LINC01021 contributes to cellular survival in response to genotoxic stress by suppressing apoptosis.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. | 
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | AGGGGTCCCTAGAGAATTTC | 27472086-27472105(+) | up stream | 20 | TGG | CRISPRko | Experimental validated | HCT116 | NA | [1] | 
| sgRNA2 | GAGGAATTCATGCCTTGCAA | 27472235-27472254(+) | up stream | 20 | AGG | CRISPRko | Experimental validated | HCT116 | NA | [1] | 
GBrowser
Links
Reference
1. Kaller M, Götz U, Hermeking H (2017). Loss of p53-inducible long non-coding RNA LINC01021 increases chemosensitivity. Oncotarget 8(61): 102783-102800.
                    
                    
                







