LIPE-AS1
Species: Homo sapiens
Position: chr19: 42397147-42652355
Known as: LIPE-AS1 , ENSG00000213904
Transcript: NR_073179 , NR_073180 , ENST00000594688 , ENST00000457234 , ENST00000594624
Sequence: Download
Description:
LIPE-AS1 and CEACAM1 were one pair of inversely regulated upon DNA damage in the microarray data and validated by RT-qPCR. The lncRNA LIPE-AS1 was downregulated, while its antisense mRNA CEACAM1 was upregulated. Through generating knockdown cell lines for LIPE-AS1 as well as CEACAM1 using the dCas9-KRAB CRISPRi system, our data indicate that neither transcript- nor transcription-dependent mechanisms explain the inverse regulation of LIPEAS1:CEACAM1 or NOP14-AS1:NOP14 expression. Hence, sense-antisense pairs whose expression is strongly--positively or negatively--correlated can be nonetheless regulated independently.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. | 
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GCCTATCGCTGCCCGAGTT | 42397072-42397090(-) | up stream | 19 | GGG | CRISPRi | Experimental validated | A549 | NA | [1] | 
| sgRNA2 | GGGCCTCTGCGGAGTGGACC | 42397164-42397183(-) | gene body (near 5') | 20 | AGG | CRISPRi | Experimental validated | A549 | NA | [1] | 
GBrowser
Links
Reference
1. Goyal A, Fiškin E, Gutschner T, Polycarpou-Schwarz M, Groß M, et al. (2017). A cautionary tale of sense-antisense gene pairs: independent regulation despite inverse correlation of expression. Nucleic Acids Res 45(21): 12496-12508.
                    
                    
                







