LOC389641
Species: Homo sapiens
Position: chr8: 23225220-23230926
Known as: LOC389641 , ENSG00000246582
Transcript: NR_033928 , ENST00000500853
Sequence: Download
Description:
LOC389641 arises from the bidirectional promoter of the TRAIL receptor TNFRSF10A. The designed five sgRNAs span the LOC389641 promoter. Combined with dCas9-KRAB, all five sgRNAs strongly inhibited the expression of LOC389641, but at the same time also decreased TNFRSF10A mRNA as well as protein expression. In this case, dCas9 alone had a modest inhibitory effect on the lncRNA LOC389641, but not on the mRNA. Hence, dCas9 displayed a slightly better specificity here not observed for NOP14-AS1, but its potency was much lower than for dCas9-KRAB preventing its alternative use.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GAAGTTCAGGGTTAGCCAAC | 23225175-23225194(-) | up stream | 20 | AGG | CRISPRi | Experimental validated | HLE | NA | [1] |
| sgRNA2 | GAATGCAGCGGCATCCACG | 23225252-23225270(-) | gene body (near 5') | 19 | CGG | CRISPRi | Experimental validated | HLE | NA | [1] |
| sgRNA3 | GACCGAGAAGCCTGGCGC | 23225296-23225313(-) | gene body (near 5') | 18 | TGG | CRISPRi | Experimental validated | HLE | NA | [1] |
| sgRNA4 | GGCGCTCGGTGGACGGAT | 23225361-23225378(+) | gene body (near 5') | 18 | GGG | CRISPRi | Experimental validated | HLE | NA | [1] |
| sgRNA5 | GGCAGGCTGAATCACTCGCC | 23225459-23225478(-) | gene body (near 5') | 20 | CGG | CRISPRi | Experimental validated | HLE | NA | [1] |
GBrowser
Links
Reference
1. Goyal A, Myacheva K, Groß M, Klingenberg M, Duran Arqué B, et al. (2017). Challenges of CRISPR/Cas9 applications for long non-coding RNA genes. Nucleic Acids Res 45(3): e12.
