Linc-cox2
Species: Mus musculus
Position: chr1: 150159042-150164948
Known as: Ptgs2os2 , ENSMUSG00000097754
Transcript: NR_110420 , ENSMUST00000181308
Sequence: Download
Description:
By establishing an NF-kB-GFP reporter system in immortalized murine bone marrow-derived macrophages upon CRISPR/Cas9 gene deletion system, Sergio Covarrubias et al. identified two long intergenic non-coding (linc) RNAs, Linc-cox2 and lincRNA-AK170409, that control NF-kB signaling. The expression of lincRNA-Cox2 is most highly induced by TLR stimulation and is directly regulated by NF-kB binding. A potential novel role for Linc-cox2 is to promote IkBa degradation in the cytoplasm. Disruption of the lincRNA-Cox2 locus leads to an overall decrease in NF-kB activity.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TCTTTGATGCAAGGAACTAC | 150165890-150165909(+) | up stream | 20 | AGG | CRISPRko | Experimental validated | iBMDM | NA | [1] |
| sgRNA2 | TTACACTGTTTATCGCTGGT | 150165720-150165739(+) | up stream | 20 | TGG | CRISPRko | Experimental validated | iBMDM | NA | [1] |
| sgRNA3 | ATCATTAACCTGTTATCATA | 150159002-150159021(-) | down stream | 20 | TGG | CRISPRko | Experimental validated | iBMDM | NA | [1] |
| sgRNA4 | CTTCAATAGACATATCTTTA | 150158482-150158501(+) | down stream | 20 | GGG | CRISPRko | Experimental validated | iBMDM | NA | [1] |
GBrowser
Links
Reference
1. Covarrubias S, Robinson EK, Shapleigh B, Vollmers A, Katzman S, et al. (2017). CRISPR/Cas-based screening of long non-coding RNAs (lncRNAs) in macrophages with an NF-κB reporter. J Biol Chem 292(51): 20911-20920.
