LncAsIR

Species: Mus musculus

Position: chr9: 102739647-102756685

Known as: Gm5627 , ENSMUSG00000093812

Transcript: NR_033301 , ENSMUST00000178539

Sequence: Download

Description:

LncAsIR is transcribed from a super enhancer region and responds robustly to insulin treatment. silencing LncAsIR resulted in an impaired global insulin-responsive gene program. LncAsIR is a novel and integral component in the insulin signalling pathway in adipocytes.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 ACTCTGACAACAGATTAACG 102756380-102756399(-) gene body (near 3') 20 AGG CRISPRi Experimental validated preadipocytes NA [1]
sgRNA2 GTCACGTATTCAGCCAATGG 102756477-102756496(-) gene body (near 3') 20 CGG CRISPRi Experimental validated preadipocytes NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Degirmenci U, Li J, Lim YC, Siang DTC, Lin S, et al. (2019). Silencing an insulin-induced lncRNA, LncASIR, impairs the transcriptional response to insulin signalling in adipocytes. Sci Rep 9(1): 5608.