LncGata6
Species: Mus musculus
Position: chr18: 10987943-11052567
Known as: 1010001N08Rik , ENSMUSG00000097222
Transcript: NR_105023 , NR_105022 , ENSMUST00000180789 , ENSMUST00000232314 , ENSMUST00000181316 , ENSMUST00000231895
Sequence: Download
Description:
LncGata6 is located on mouse chromosome 18, harbouring four exons as a divergent lncRNA for the Gata6 gene LncGata6 was highly conserved in different species. LncGata6 was highly expressed in mouse small intestine and colon with a single transcript. The LncGata6 transcript was 730 nt long, with no protein-coding potential. Of note, lncGata6 was mainly distributed in the nuclei of ISC cells. Here, we show that a divergent Gata6 lncRNA (lncGata6) is required for the maintenance of ISC stemness and promotes intestinal tumorigenesis as well.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | AACAAACAGCGCTAGCCGAA | 11052527-11052546(-) | gene body (near 5') | 20 | GGG | CRISPRi | Experimental validated | embryo | NA | [1] |
| sgRNA2 | AAAGACTAGCTTTCCGAAAG | 11050004-11050023(-) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | embryo | NA | [1] |
| sgRNA3 | TAACGCGTTGAGAAGGAGCG | 11051604-11051623(-) | gene body (near 5') | 20 | GGG | CRISPRko | Experimental validated | embryo | NA | [1] |
| sgRNA4 | CAGCCTGAGGCCGATAGGGG | 11049799-11049818(+) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | embryo | NA | [1] |
| sgRNA5 | TTATTGGCTGGCGTTCCGAA | 11048870-11048889(+) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | embryo | NA | [1] |
| sgRNA6 | CATTCGGACTCTAGAGGCTG | 11050150-11050169(-) | gene body (near 5') | 20 | GGG | CRISPRko | Experimental validated | embryo | NA | [1] |
| sgRNA7 | AGGGCTCGGTGAGTCCAATC | 11052548-11052567(+) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | embryo | NA | [1] |
GBrowser
Links
Reference
1. Zhu P, Wu J, Wang Y, Zhu X, Lu T, et al. (2018). LncGata6 maintains stemness of intestinal stem cells and promotes intestinal tumorigenesis. Nat Cell Biol 20(10): 1134-1144.
