LncHand2
Species: Mus musculus
Position: chr8: 57304413-57320859
Known as: AV026068 , ENSMUSG00000100510
Transcript: NR_110474 , ENSMUST00000189143
Sequence: Download
Description:
LncHand2 is constitutively expressed in the nuclei of pericentral hepatocytes in mouse and human livers. LncHand2 knockout abrogates liver regeneration and repopulation capacity. Mechanistically, lncHand2 recruits the Ino80 remodeling complex to initiate expression of Nkx1-2 in trans, which triggers c-Met expression in hepatocytes. Finally, double knockout of Nkx1-2 and c-Met causes more severe liver injury and poorer repopulation ability. Thus lncHand2 promotes liver repopulation via initiating Nkx1-2-induced c-Met signaling. Our findings reveal that lncHand2 acts as a critical mediator to regulate liver repopulation.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | ATACTGAAGAATCTTAAACC | 57320691-57320710(-) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | embryo | paried with sgRNA2,3,4 | [1] |
| sgRNA2 | ACGACATATATTAACCCGAG | 57320948-57320967(+) | up stream | 20 | CGG | CRISPRko | Experimental validated | embryo | paried with sgRNA1 | [1] |
| sgRNA3 | AAGCAGGTTTAGTTATCGGA | 57320047-57320066(-) | gene body (near 5') | 20 | GGG | CRISPRko | Experimental validated | embryo | paried with sgRNA1 | [1] |
| sgRNA4 | TGGTGGCGACAAGAGTCTGG | 57320502-57320521(-) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | embryo | paried with sgRNA1 | [1] |
| sgRNA5 | CCATGTTGTACTGATTCAGT | 57304432-57304451(-) | gene body (near 3') | 20 | GGG | CRISPRki | Experimental validated | embryo | NA | [1] |
GBrowser
Links
Reference
1. Wang Y, Zhu P, Wang J, Zhu X, Luo J, et al. (2018). Long noncoding RNA LncHand2 promotes liver repopulation via c-Met signaling. J Hepatol.
