LncKdm2b
Species: Mus musculus
Position: chr5: 122989353-122998345
Known as: A930024E05Rik , ENSMUSG00000056735
Transcript: NR_045820 , ENSMUST00000148466
Sequence: Download
Description:
lncKdm2b, a divergent lncRNA against Kdm2b gene, is conserved among five mammalian species and highly expressed in embryonic stem cells (ESCs) and early embryos. LncKdm2b knockout impairs ESC self-renewal and causes early embryonic lethality. LncKdm2b can activate Zbtb3 by promoting the assembly and ATPase activity of Snf2-related CREBBP activator protein (SRCAP) complex in trans.
lncKdm2b, was expressed at high levels in intestinal group 3 ILCs (ILC3s). To determine the in vivo role of lncKdm2b in the development of immune cells, lncKdm2bflox/flox mice via CRISPR-Cas9 technology were established and crossed with Vav-Cre mice to generate lncKdm2bflox/flox; Vav-Cre+ mice. LncKdm2b was completely deleted in the BM of these mice. LncKdm2b deficiency in the hematopoietic system led to reductions in the number and effector functions of ILC3s. Mechanistically, lncKdm2bexerts its regulatory functions in trans by recruiting the chromatin organizer Satb1 and the nuclear remodeling factor (NURF) complex onto the Zfp292 promoter to initiate its transcription.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GGTCAAAACTTGTATAAGAT | 122994007-122994026(-) | gene body (near 3') | 20 | TGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA2 | [1] |
| sgRNA2 | GACCGGATCTCTCCTATCAA | 122994835-122994854(+) | gene body (near 3') | 20 | AGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA1 | [1] |
| sgRNA3 | TATCACCTGATGCAGACCTG | 122993772-122993791(+) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA4 | [2] |
| sgRNA4 | GGAATCAGCTGACCTGGCTG | 122994911-122994930(+) | gene body (near 3') | 20 | AGG | CRISPRko | Experimental validated | ESCs | paried with sgRNA3 | [2] |
| sgRNA5 | CTTAGTCTCTGAGTTAGATG | 122998346-122998365(+) | down stream | 20 | TGG | CRISPRko | Experimental validated | ESCs | NA | [2] |
GBrowser
Links
Reference
1. Ye B, Liu B, Yang L, Zhu X, Zhang D, et al. (2018). LncKdm2b controls self-renewal of embryonic stem cells via activating expression of transcription factor Zbtb3. EMBO J 37(8).
2. Liu B, Ye B, Yang L, Zhu X, Huang G, et al. (2017). Long noncoding RNA lncKdm2b is required for ILC3 maintenance by initiation of Zfp292 expression. Nat Immunol 18(5): 499-508.