MLLT4-AS1

Species: Homo sapiens

Position: chr6: 167825028-167825460

Known as:

Transcript: ENST00000417244

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 AGCAAGCTTTGTGAATTGTA 167825340-167825359(-) gene body (near 5') 20 GGG CRISPRi Partial validated MCF7 NA [1]
sgRNA2 GCGCTCTGCAGCCAAAACAA 167825264-167825283(+) gene body (near 5') 20 AGG CRISPRi Partial validated MCF7 NA [1]
sgRNA3 CTGCAGCCAAAACAAAGGGT 167825269-167825288(+) gene body (near 5') 20 GGG CRISPRi Partial validated MCF7 NA [1]
sgRNA4 CGCCTGACTGAACCCGGCGT 167825226-167825245(+) gene body (near 3') 20 GGG CRISPRi Partial validated MCF7 NA [1]
sgRNA5 TTTCAGGTTTCCACGTCCAC 167825371-167825390(+) gene body (near 5') 20 GGG CRISPRi Partial validated MCF7 NA [1]
sgRNA6 CGATCACGTGGCATCTCTCA 167825417-167825436(+) gene body (near 5') 20 GGG CRISPRi Partial validated MCF7 NA [1]
sgRNA7 GGCATCTCTCAGGGCCAAAT 167825426-167825445(+) gene body (near 5') 20 GGG CRISPRi Partial validated MCF7 NA [1]
sgRNA8 CAGAGTTAATAAACGTCGAG 167825466-167825485(-) up stream 20 GGG CRISPRi Partial validated MCF7 NA [1]
sgRNA9 AAATCCTGTACGTGTCCCCG 167825390-167825409(-) gene body (near 5') 20 TGG CRISPRi Partial validated MCF7 NA [1]
sgRNA10 ACGTCCACGGGGACACGTAC 167825383-167825402(+) gene body (near 5') 20 AGG CRISPRi Partial validated MCF7 NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).