MNX1-AS1
Species: Homo sapiens
Position: chr7: 157010804-157016426
Known as: MNX1-AS1 , ENSG00000243479
Transcript: NR_038835 , ENST00000480284
Sequence: Download
Description:
MNX1-AS1 arises from the bidirectional promoter of MNX1. In NCI-H460 lung cancer cells, dCas9-KRAB-mediated knockdown of MNX1-AS1 using three independent sgRNAs led to knockdown of both MNX1-AS1 as well as its neighboring mRNA MNX1, while MNX1-AS1 knockdown using two independent ASOs reduced MNX1-AS1 expression without affecting MNX1 expression.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GGGCGCACCTGTCACCGTCC | 157010765-157010784(+) | up stream | 20 | CGG | CRISPRi | Experimental validated | NCI-H460 | NA | [1] |
| sgRNA2 | GGAGTATCCACTCCCCGT | 157010867-157010884(-) | gene body (near 5') | 18 | TGG | CRISPRi | Experimental validated | NCI-H460 | NA | [1] |
| sgRNA3 | GGTTGCCAGTGCCCGCCGTC | 157010933-157010952(-) | gene body (near 5') | 20 | CGG | CRISPRi | Experimental validated | NCI-H460 | NA | [1] |
GBrowser
Links
Reference
1. Goyal A, Myacheva K, Groß M, Klingenberg M, Duran Arqué B, et al. (2017). Challenges of CRISPR/Cas9 applications for long non-coding RNA genes. Nucleic Acids Res 45(3): e12.
