NOP14-AS1
Species: Homo sapiens
Position: chr4: 2934898-2961738
Known as: NOP14-AS1 , ENSG00000249673
Transcript: NR_015453 , ENST00000515194 , ENST00000512712 , ENST00000505731 , ENST00000503709 , ENST00000507999
Sequence: Download
Description:
The lncRNA NOP14-AS1 was transcribed in a tail-to-tail orientation with the coding gene NOP14, and strongly upregulated upon DNA damage. As a sense-antisense gene pair, NOP14-AS1 and NOP14 are inversely correlated upon DNA damage, whose regulation of both depend on p53. By using CRISPRi and CRISPRa for both of NOP14-AS1 and NOP14, we identified inverse but independent regulation of sense-antisense pairs, highlighting the requirement of individual experimental studies for each antisense pair and prohibition of drawing conclusions on regulatory mechanisms from expression correlations. NOP14-AS1 deletion using Cas9 or knockdown using dCas9/dCas9-KRAB affects MFSD10 expression.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GACGGACGGTCGCACAGACG | 2934790-2934809(+) | up stream | 20 | CGG | CRISPRa;CRISPRi | High activity | HEK293;NCI-H460 | NA | [1] [2] |
| sgRNA2 | GGTCGCACAGACGCGGAACA | 2934797-2934816(+) | up stream | 20 | GGG | CRISPRi | Experimental validated | NCI-H460 | NA | [1] |
| sgRNA3 | ACAGCCAAGCAGCGACCCGC | 2934940-2934959(-) | gene body (near 5') | 20 | AGG | CRISPRa;CRISPRi | High activity | HEK293;NCI-H460 | NA | [1] [2] |
| sgRNA4 | GTCTCGGCCTCGGGGTTACG | 2935005-2935024(-) | gene body (near 5') | 20 | CGG | CRISPRi | Experimental validated | HEK293;NCI-H460 | NA | [2] |
| sgRNA5 | GCCCATGGGTCCGCTCCGCG | 2935062-2935081(-) | gene body (near 5') | 20 | GGG | CRISPRi | Experimental validated | HEK293;NCI-H460 | NA | [2] |
| sgRNA6 | AGAGATGTACGTCACTTCCG | 2934872-2934891(-) | up stream | 20 | GGG | CRISPRi;CRISPRko | Experimental validated | HEK293;NCI-H460 | paried with sgRNA7 | [2] |
| sgRNA7 | AAGTAGGACAAGGCCAACTG | 2937847-2937866(+) | gene body (near 5') | 20 | TGG | CRISPRko | Experimental validated | HEK293;NCI-H460 | paried with sgRNA6 | [2] |
GBrowser
Links
Reference
1. Goyal A, Fiškin E, Gutschner T, Polycarpou-Schwarz M, Groß M, et al. (2017). A cautionary tale of sense-antisense gene pairs: independent regulation despite inverse correlation of expression. Nucleic Acids Res 45(21): 12496-12508.
2. Goyal A, Myacheva K, Groß M, Klingenberg M, Duran Arqué B, et al. (2017). Challenges of CRISPR/Cas9 applications for long non-coding RNA genes. Nucleic Acids Res 45(3): e12.