Neat1
Species: Mus musculus
Position: chr19: 5824707-5845480
Known as: Neat1 , ENSMUSG00000092274
Transcript: NR_131212 , NR_003513 , ENSMUST00000174287
Sequence: Download
Description:
The abundance of NEAT1 and its rodent homolog (Neat1) are increased in the brains of aging humans and mice and are linked to multiple cognitive and neurodegenerative disorders, including schizophrenia, Huntington's disease, Parkinson's disease, Alzheimer's disease, and epilepsy. Used RNA sequencing (RNA-seq) in mouse and human tissue, CRISPR-mediated gene activation (CRISPRa) in vivo, and behavioral memory tests in mice to investigate the functional role of NEAT1 in gene expression dynamics and the role that age-related changes in its expression might play in memory deficits seen in older adults.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TCATCCTGTGACGCACCGCT | 5845682-5845701(-) | up stream | 20 | AGG | CRISPRa | Experimental validated | C57BL/6 | NA | [1] |
GBrowser
Links
Reference
1. Butler AA, Johnston DR, Kaur S, Lubin FD (2019). Long noncoding RNA NEAT1 mediates neuronal histone methylation and age-related memory impairment. Sci Signal 12(588).
