PCAT19

Species: Homo sapiens

Position: chr19: 41454168-41500649

Known as: PCAT19 , ENSG00000267107

Transcript: NR_136334 , NR_040109 , ENST00000588495 , ENST00000594315

Sequence: Download

Description:

The prostate cancer (PCa) risk-associated SNP rs11672691 is positively associated with aggressive disease at diagnosis. We showed that rs11672691 maps to the promoter of a short isoform of long noncoding RNA PCAT19 (PCAT19-short), which is in the third intron of the long isoform (PCAT19-long). The risk variant is associated with decreased and increased levels of PCAT19-short and PCAT19-long, respectively. Mechanistically, the risk SNP region is bifunctional with both promoter and enhancer activity. The risk variants of rs11672691 and its LD SNP rs887391 decrease binding of transcription factors NKX3.1 and YY1 to the promoter of PCAT19-short, resulting in weaker promoter but stronger enhancer activity that subsequently activates PCAT19-long. PCAT19-long interacts with HNRNPAB to activate a subset of cell-cycle genes associated with PCa progression, thereby promoting PCa tumor growth and metastasis. Taken together, these findings reveal a risk SNP-mediated promoter-enhancer switching mechanism underlying both initiation and progression of aggressive PCa.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 GTAACGAGACCCTTAATCGC 41479518-41479537(-) gene body (near 5') 20 TGG CRISPRi;CRISPRa Experimental validated V16A;LNCaP NA [1]
sgRNA2 TTTCTCCACTAGCATTTCCA 41479610-41479629(+) gene body (near 5') 20 TGG CRISPRi;CRISPRa Experimental validated V16A;LNCaP NA [1]
sgRNA3 ACTGAGTGAAAAGAAAAGCC 41501312-41501331(+) up stream 20 CGG CRISPRi;CRISPRa Experimental validated V16A;LNCaP NA [1]
sgRNA4 TGAGTGAAAAGAAAAGCCCG 41501314-41501333(+) up stream 20 GGG CRISPRi;CRISPRa Experimental validated V16A;LNCaP NA [1]
sgRNA5 GGTAAAATGCCTCCACTCTCC 41501236-41501255(-) up stream 21 AGG CRISPRa Experimental validated LNCaP NA [1]
sgRNA6 GGGAAGGCAGCTGCTTCTAAT 41501292-41501311(-) up stream 21 TGG CRISPRa Experimental validated LNCaP NA [1]
sgRNA7 CTGAGTGAAAAGAAAAGCCCG 41501313-41501333(+) up stream 21 GGG CRISPRa Experimental validated LNCaP NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Hua JT, Ahmed M, Guo H, Zhang Y, Chen S, et al. (2018). Risk SNP-Mediated Promoter-Enhancer Switching Drives Prostate Cancer through lncRNA PCAT19. Cell 174(3): 564-575.e18.