PSMB8-AS1

Species: Homo sapiens

Position: chr6: 4038373-32846500

Known as: PSMB8-AS1 , ENSG00000204261

Transcript: NR_037173 , NR_037174 , NR_037175 , NR_037176

Sequence: Download

Description:

PSMB8-AS1 repression inhibits influenza virus replication. PSMB8-AS1 was induced by different influenza virus strains and type I IFN. The role of PSMB8-AS1 may not be only limited to viral pathogenesis but may be involved in modulation of IFN response.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 GAAGCCGGTCCCCAGTGTGA 32844142-32844161(-) gene body (near 3') 20 TGG CRISPRi Experimental validated A549 NA [1]
sgRNA2 GCGGACAGATCTCTGGGTGC 32844006-32844025(-) gene body (near 3') 20 TGG CRISPRi Experimental validated A549 NA [1]
sgRNA3 GATCTGTCCGCTCTCGGAGG 32844015-32844034(+) gene body (near 3') 20 AGG CRISPRi Experimental validated A549 NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. More S, Zhu Z, Lin K, Huang C, Pushparaj S, et al. (2019). Long non-coding RNA PSMB8-AS1 regulates influenza virus replication. RNA Biol 16(3): 340-353.