Peat
Species: Mus musculus
Position: chr2: 147361540-147362793
Known as: AI646519 , ENSMUSG00000087521
Transcript: NR_040330 , ENSMUST00000140987
Sequence: Download
Description:
Peat lncRNA is located just upstream of the Pax1 gene. Using CRISPR/Cas9, a mouse line bearing a complete deletion of the Peat-transcribed unit was generated. RNA-seq on Peat mutant embryos showed that loss of Peat modestly increases bone morphogenetic protein target gene expression and also elevates the expression of a large subset of ribosomal protein mRNAs.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | ACTTTAGCTACTCTTTGAGC | 147362828-147362847(+) | up stream | 20 | TGG | CRISPRko | High activity | embryo | Seven of the 9 resulting pups carried the designed deletion | [1] |
| sgRNA2 | TGTAAGGACAGACTACGCAA | 147361446-147361465(-) | down stream | 20 | CGG | CRISPRko | High activity | embryo | Seven of the 9 resulting pups carried the designed deletion | [1] |
GBrowser
Links
Reference
1. Stafford DA, Dichmann DS, Chang JK, Harland RM (2017). Deletion of the sclerotome-enriched lncRNA PEAT augments ribosomal protein expression. Proc Natl Acad Sci U S A 114(1): 101-106.
