Playrr
Species: Mus musculus
Position: chr3: 128117014-128231605
Known as: D030025E07Rik , ENSMUSG00000105816
Transcript: NR_045704 , ENSMUST00000197413
Sequence: Download
Description:
Genes immediately neighboring Pitx2 in chicken and mouse, including a long noncoding RNA, Playrr (Pitx2 locus asymmetric regulated RNA), are expressed on the right side and repressed by Pitx2. Our data demonstrate chromatin-level regulation that mirrors LR organogenesis and that tissue-specific cis-regulatory topology establishes LR transcription among higher vertebrates.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | TAGACGCAGCTGTGCTTAGA | 128231320-128231339(-) | gene body (near 5') | 20 | AGG | CRISPRedit | Experimental validated | embryo | NA | [1] |
| sgRNA2 | GTGGCGGACTCATGTTAAAA | 128230282-128230301(+) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | embryo | NA | [1] |
| sgRNA3 | GTGATTCCCACCACGCTTTG | 128231555-128231574(-) | gene body (near 5') | 20 | AGG | CRISPRko | Experimental validated | embryo | NA | [1] |
GBrowser
Links
Reference
1. Welsh IC, Kwak H, Chen FL, Werner M, Shopland LS, et al. (2015). Chromatin Architecture of the Pitx2 Locus Requires CTCF- and Pitx2-Dependent Asymmetry that Mirrors Embryonic Gut Laterality. Cell Rep 13(2): 337-49.
