ROSA26
Species: Oryctolagus cuniculus
Position: chrUn0104: 666248-673441
Known as: LOC103345511
Transcript: XR_515376 , XR_515377
Sequence: Download
Description:
The present work identifies a safe harbor locus, ROSA26, in the rabbit genome. The ROSA26 encodes two ubiquitously expressed noncoding RNA variants, and is amenable to nuclease mediated knock-in. Disruption of the ROSA26 does not lead to abnormality in animal health and reproduction. We expect that using ROSA26 for transgenic applications will facilitate the development of rabbit models for translational sciences and therapeutics.
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | GGAGCATGCAGCTTTTTCTT | 670792-670811(+) | gene body (near 5') | 20 | GGG | CRISPRki | High activity | embryo | Mutation rate 35% | [1] |
GBrowser
Links
Reference
1. Yang D, Song J, Zhang J, Xu J, Zhu T, et al. (2016). Identification and characterization of rabbit ROSA26 for gene knock-in and stable reporter gene expression. Sci Rep 6: 25161.
