RP11-279F6.1
Species: Homo sapiens
Position: chr15: 69468035-69571083
Known as:
Transcript: ENST00000560882 , ENST00000498938
Sequence: Download
Description:
We report a high throughput genomic deletion strategy to screen for functional long non-coding RNAs (lncRNAs) that is based on a lentiviral paired-guide RNA (pgRNA) library. Applying our screening method, we identified 51 lncRNAs that can positively or negatively regulate human cancer cell growth. We used the MAGeCK algorithm to identify the top hits by comparing samples from day 30 with day-0 controls. The output of MAGeCK is a set of negatively (or positively) selected lncRNAs, or lncRNAs whose knockout disrupts (or stimulates) cell proliferation. In total, MAGeCK identified 43 negatively selected and 8 positively selected lncRNAs with statistical significance (false discovery rate < 0.25).
sgRNAs
| sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
|---|---|---|---|---|---|---|---|---|---|---|
| sgRNA1 | CGAGGCCTGCCAATTCACGG | 69577971-69577990(+) | down stream | 20 | TGG | CRISPRko | Partial validated | Huh7.5 | NA | [1] |
| sgRNA2 | CCTGTTGCTGTCAAACACGC | 69500064-69500083(+) | gene body (near 5') | 20 | TGG | CRISPRko | Partial validated | Huh7.5 | NA | [1] |
| sgRNA3 | GAGATGAAGTAGGTTCAGCC | 69571743-69571762(+) | down stream | 20 | AGG | CRISPRko | Partial validated | Huh7.5 | NA | [1] |
| sgRNA4 | TTGTTATCTGAAGTCAGGCA | 69531839-69531858(+) | gene body (near 3') | 20 | AGG | CRISPRko | Partial validated | Huh7.5 | NA | [1] |
GBrowser
Links
Reference
1. Zhu S, Li W, Liu J, Chen CH, Liao Q, et al. (2016). Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nat Biotechnol 34(12): 1279-1286.
