RP11-339B21.10

Species: Homo sapiens

Position: chr9: 128431597-128432006

Known as:

Transcript: ENST00000610052

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 GGCCGGGAGAAGAGGCTTCT 128431722-128431741(+) gene body (near 5') 20 AGG CRISPRi Partial validated U87 NA [1]
sgRNA2 GCAGTGGAGGGGAGAGGTAT 128431643-128431662(+) gene body (near 5') 20 GGG CRISPRi Partial validated U87 NA [1]
sgRNA3 TTCTGACCCCCTCCCACACG 128431684-128431703(-) gene body (near 5') 20 AGG CRISPRi Partial validated U87 NA [1]
sgRNA4 AGAGGTGCCTCGTGTGGGAG 128431674-128431693(+) gene body (near 5') 20 GGG CRISPRi Partial validated U87 NA [1]
sgRNA5 AATCAAAACCAAGCTTGCAG 128431627-128431646(+) gene body (near 5') 20 TGG CRISPRi Partial validated U87 NA [1]
sgRNA6 CTCTTCTCCCGGCCCCTCAA 128431716-128431735(-) gene body (near 5') 20 TGG CRISPRi Partial validated U87 NA [1]
sgRNA7 ATGGGAACTGGGCCCTCCAA 128431910-128431929(+) gene body (near 3') 20 GGG CRISPRi Partial validated U87 NA [1]
sgRNA8 ACACGAGGCACCTCTCAAAG 128431669-128431688(-) gene body (near 5') 20 TGG CRISPRi Partial validated U87 NA [1]
sgRNA9 AAACCAAGCTTGCAGTGGAG 128431632-128431651(+) gene body (near 5') 20 GGG CRISPRi Partial validated U87 NA [1]
sgRNA10 GCAATAAAGGGATCCCCCTG 128431578-128431597(+) gene body (near 5') 20 GGG CRISPRi Partial validated U87 NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).