RP11-457M11.2
Species: Homo sapiens
Position: chr6: 26634392-26659752
Known as:
Transcript: ENST00000456172
Sequence: Download
Description:
We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.
sgRNAs
sgRNA_ID | Sequence | Position (Chr) | Position (Lnc) | Length | PAM | Type | Validity | Cell line | Note | Ref. |
---|---|---|---|---|---|---|---|---|---|---|
sgRNA1 | GTACATCAGGGAACTCACAT | 26636669-26636688(-) | gene body (near 3') | 20 | AGG | CRISPRi | Partial validated | iPSC | NA | [1] |
sgRNA2 | CTTGCAGTCTTTCCTCAGAT | 26636729-26636748(+) | gene body (near 3') | 20 | TGG | CRISPRi | Partial validated | iPSC | NA | [1] |
sgRNA3 | TGGGTCAGAGTAGACCTGAT | 26636400-26636419(-) | gene body (near 3') | 20 | GGG | CRISPRi | Partial validated | iPSC | NA | [1] |
sgRNA4 | TCAACTCTTGTGGTACATCA | 26636681-26636700(-) | gene body (near 3') | 20 | GGG | CRISPRi | Partial validated | iPSC | NA | [1] |
sgRNA5 | TTTGGGTGCAAACCCAAGTA | 26636761-26636780(+) | gene body (near 3') | 20 | AGG | CRISPRi | Partial validated | iPSC | NA | [1] |
sgRNA6 | GCTTGTTCTGGGAGAAGCTA | 26636423-26636442(-) | gene body (near 3') | 20 | GGG | CRISPRi | Partial validated | iPSC | NA | [1] |
sgRNA7 | CTCAGACTCAAGGTAAGTAT | 26636635-26636654(+) | gene body (near 3') | 20 | GGG | CRISPRi | Partial validated | iPSC | NA | [1] |
sgRNA8 | TTCGTTGGAGAGCCTTACTT | 26636776-26636795(-) | gene body (near 3') | 20 | GGG | CRISPRi | Partial validated | iPSC | NA | [1] |
sgRNA9 | GTTCTGGGAGAAGCTAGGGT | 26636419-26636438(-) | gene body (near 3') | 20 | GGG | CRISPRi | Partial validated | iPSC | NA | [1] |
GBrowser
Links
Reference
1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).