RP11-457M11.2

Species: Homo sapiens

Position: chr6: 26634392-26659752

Known as:

Transcript: ENST00000456172

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 GTACATCAGGGAACTCACAT 26636669-26636688(-) gene body (near 3') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 CTTGCAGTCTTTCCTCAGAT 26636729-26636748(+) gene body (near 3') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 TGGGTCAGAGTAGACCTGAT 26636400-26636419(-) gene body (near 3') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 TCAACTCTTGTGGTACATCA 26636681-26636700(-) gene body (near 3') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 TTTGGGTGCAAACCCAAGTA 26636761-26636780(+) gene body (near 3') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 GCTTGTTCTGGGAGAAGCTA 26636423-26636442(-) gene body (near 3') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 CTCAGACTCAAGGTAAGTAT 26636635-26636654(+) gene body (near 3') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 TTCGTTGGAGAGCCTTACTT 26636776-26636795(-) gene body (near 3') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 GTTCTGGGAGAAGCTAGGGT 26636419-26636438(-) gene body (near 3') 20 GGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).