RP11-486G15.2

Species: Homo sapiens

Position: chr1: 84076330-84077931

Known as:

Transcript: ENST00000605506

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 TGGCCCGACTGTATCTTCGC 84077976-84077995(-) up stream 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 CCGGGCCTGCGCGTCACTTC 84077938-84077957(+) up stream 20 CGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 AACCCCGAGGACAACGTGGT 84077459-84077478(+) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 GCACCGGGACCGCCAGGGTG 84077744-84077763(+) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 GTGCCCATCGCTGAGATAGT 84077813-84077832(-) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 ATCGCTGAGATAGTGGGAGG 84077807-84077826(-) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 CCGCCTGCGAAGATACAGTC 84077970-84077989(+) up stream 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 CCCATCGCTGAGATAGTGGG 84077810-84077829(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 GCGCAGGCCCGGGACCCCGG 84077930-84077949(-) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).