RP3-339A18.6

Species: Homo sapiens

Position: chrX: 53432721-53433032

Known as:

Transcript: ENST00000418049

Sequence: Download

Description:

We developed a CRISPR interference (CRISPRi) platform targeting 16,401 lncRNA loci in seven diverse cell lines, including six transformed cell lines and human induced pluripotent stem cells (iPSCs). We classified lncRNA genes as hits if their combined phenotype effect size and P value (referred to here as “screen score”) exceeded a consistent threshold applied to each screen corresponding to an empirical FDR of 5%. Large-scale screening identified 499 lncRNA loci required for robust cellular growth, of which 89% showed growth modifying function exclusively in one cell type.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 AGGTCAAAGGTGAAAATATT 53432867-53432886(+) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA2 AAATTGAGAGAGTAGGTCAA 53432854-53432873(+) gene body (near 3') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA3 AAAAAAAAAATTGAGAGAGT 53432847-53432866(+) gene body (near 3') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA4 GGTTGTAAAACTTGAGAGAT 53432547-53432566(+) down stream 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA5 CTGCACCCAGCCTCACAACA 53432999-53433018(-) gene body (near 5') 20 GGG CRISPRi Partial validated iPSC NA [1]
sgRNA6 CTGAAGATTCTTAATTGCTG 53432955-53432974(+) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA7 ATGCAACCCTGTTGTGAGGC 53432990-53433009(+) gene body (near 5') 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA8 AAGTTTTACAACCTTTCTCT 53432540-53432559(-) down stream 20 TGG CRISPRi Partial validated iPSC NA [1]
sgRNA9 ACTAATGCAACCCTGTTGTG 53432986-53433005(+) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]
sgRNA10 AGCATGTGAATTTATCAAGA 53432934-53432953(-) gene body (near 5') 20 AGG CRISPRi Partial validated iPSC NA [1]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Liu SJ, Horlbeck MA, Cho SW, Birk HS, Malatesta M, et al. (2017). CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science 355(6320).